View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1165_low_20 (Length: 201)

Name: NF1165_low_20
Description: NF1165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1165_low_20
NF1165_low_20
[»] chr2 (1 HSPs)
chr2 (1-127)||(43416632-43416758)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 43416758 - 43416632
Alignment:
1 tagttaagctgtgcttcagatataatactctattgtcttgtcacttcagtatggcagcataagaattaggaataaaggaaagaatgcataaagaatctct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
43416758 tagttaagctgtgcttcagatataatactctattgtcttgtcacttcagcatggcagcataagaattaggaataaaggaaagaatgcataaagaatctct 43416659  T
101 tgtgcaacacttctttctcctatgata 127  Q
    |||||||||||||||||||||||||||    
43416658 tgtgcaacacttctttctcctatgata 43416632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University