View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11660_high_25 (Length: 330)
Name: NF11660_high_25
Description: NF11660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11660_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 21 - 313
Target Start/End: Complemental strand, 52126751 - 52126459
Alignment:
| Q |
21 |
tcaccaactgaaaaatggcgttgctagtgtcttggatgtcaacattacttttggcatcggaaagtatttggggttgtcatccatgattggaaggaacaaa |
120 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52126751 |
tcaccaactgaaaaatggtgttgctagtgtcttggatgtcaacattacttttggcatcggaaagtatttggggttgtcatccatgattggaaggaacaaa |
52126652 |
T |
 |
| Q |
121 |
aaatcagtcttcgatttcatcaaggacaaggtttggcaaaaaataaattcttggaagagtaaagctttgtctcgcgctagtagagaagatctcataaatt |
220 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52126651 |
aaatcggtcttcgatttcatcaaggataaggtttggcaaaaaataacttcttggaagagtaaagctttgtctcgcgctagtagagaagatctcataaatt |
52126552 |
T |
 |
| Q |
221 |
tcgtggttcaatcaatttcaacttatatcatgagcatttttccaatccctcaatctcttgttgatgacactcaaaagatgatgaactcctttt |
313 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52126551 |
ttatggttcaatcaatttcaacttatatgatgagcatttttccaatccctcaatctcttgttgatgacactcaaaagatgatgaactcctttt |
52126459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University