View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11660_low_38 (Length: 292)
Name: NF11660_low_38
Description: NF11660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11660_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 281
Target Start/End: Complemental strand, 4496232 - 4495970
Alignment:
| Q |
21 |
atgtaagatcctaaatatcattgtttggggaccacttctctactatttggaccaatatagtactcaaaaaattatctgagccttccaagttgacatttca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4496232 |
atgtaagatcctaaatatcattgtttggggaccacttctctactagttggaccaatatagtactcaaaaaattatccgagccttccaagttgacatttca |
4496133 |
T |
 |
| Q |
121 |
attaagatacttaaattgctggttaatactaacagcatgaccattctcacaaactcactaacattcca--nnnnnnnnccatccttagcattattccact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
4496132 |
attaagatacttaaattgctggttaatactaacagcatgaccattctcacaaactcactaacattccattttttttttccatccttagcattattcaact |
4496033 |
T |
 |
| Q |
219 |
gtggaattatgattatgaccattgacctttccctttaccatgcatataaatgtgtgtattcat |
281 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4496032 |
atggaattgtgattatgaccattgacctttccctttaccatgcatataaatgtgtgtattcat |
4495970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University