View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11660_low_43 (Length: 256)
Name: NF11660_low_43
Description: NF11660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11660_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 7968387 - 7968165
Alignment:
| Q |
1 |
acaaccgtattactttagaaaactagactcgactaagatttcatctattaatagcacaaaattgtctaatattgttttgtaaaattgctagtatcagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7968387 |
acaaccgtattactttagaaaactagactcgactaagatttcgtctattaatagcacaaaattgtgtaatattgttttgtaaaattgctagtatcagcta |
7968288 |
T |
 |
| Q |
101 |
aactctttaacatgtaggnnnnnnnttagaagattaaagctcaaccctctaatccaatccaatccaagtagtaagcctctagcttctttagccgaccaaa |
200 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7968287 |
aactctttaatatgtaggaaaaaaattagaagattaaagctcaaccctct-----aatccaatccaagtagtaagcctctagcttctttagccg------ |
7968199 |
T |
 |
| Q |
201 |
ttaatctcttagaaaaatgtcaatttctgactctac |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7968198 |
--aatctcttagaaaaatgtcaatttctgactctac |
7968165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University