View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11660_low_47 (Length: 240)
Name: NF11660_low_47
Description: NF11660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11660_low_47 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 42467990 - 42467767
Alignment:
| Q |
17 |
actatttctatattcagtttagttcatatgcaacgtacaaaactatcagccaccatgctattcacgatctcagacgaagtctttccattgttttcatttt |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42467990 |
actatttctatattcagtttagttcgtatgcaacgtacaaaactatcagccaccatgctattcacgatctcagacgaactctttccattgttttcatttt |
42467891 |
T |
|
| Q |
117 |
tgtaacgcctgttttgtgaaacatctgactgatccccttttgtgctaaggtggtgtctggcgacgatgagcctaagagaaatgattttggtgaacgaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42467890 |
tgtaacgcctgttttgtgaaacatctgactgatccccttttgagctaaggtggtgtctggagatgatgagcctaagagagatgattttggtgaacgaagg |
42467791 |
T |
|
| Q |
217 |
aaaaaatacgagaaatgggtgtta |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42467790 |
aaaaaatacgagaaatgggtgtta |
42467767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University