View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_high_19 (Length: 293)
Name: NF11661_high_19
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_high_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 45 - 255
Target Start/End: Complemental strand, 46748902 - 46748692
Alignment:
| Q |
45 |
gtataagacaccagatacgcctttaattaaaagtgtccgtgcaaccgagatggtaacttttggtttttcttgctactagacaggtgcaaacccttttatg |
144 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748902 |
gtatcagacaccagacacacctttaattaaaagtgtccgtgcaaccgagatggtaacttttggtttttcttgctactagacaggtgcaaacccttttatg |
46748803 |
T |
|
| Q |
145 |
cgatagtgcatgtgacatttttgtgatatgtatgactctgatattatgaggctttataaaaaattgtctccaacttctcattttaaatgccaccaatttg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748802 |
tgatagtgcatgtgacatttttgtgatatgtatgactctgatattatgaggctttataaaaaattgtctccaacttctcattttaaatgccaccaatttg |
46748703 |
T |
|
| Q |
245 |
ttcaggaattc |
255 |
Q |
| |
|
|||| |||||| |
|
|
| T |
46748702 |
ttcaagaattc |
46748692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University