View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_18 (Length: 311)
Name: NF11661_low_18
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 201
Target Start/End: Original strand, 32062450 - 32062634
Alignment:
| Q |
17 |
acatggtaaccgtaattactgagagaaagggtttatagagagagaaagagatagtgcatgcaaaatgcatatataacatacaaacacaatacacgcacgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062450 |
acatggtaaccgtaattactgagagaaagggtttatagagagagaaagagatagtgcatgcaaaatgcatatataacatacaaacacaatacacgcacgc |
32062549 |
T |
|
| Q |
117 |
atagagataaagattgtgcaaaatgcatgcatactcattattattgtttcattcataatccataataataacaccgtttacctta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32062550 |
atagagataaagattgtgcaaaatgcatgcatactcattattattgtttcattcataatccataataataacaccgtttacctta |
32062634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 240 - 301
Target Start/End: Original strand, 32062673 - 32062736
Alignment:
| Q |
240 |
aacataaaaaccttacctgtttctactgcttttctaggttga--ctcgcttgtttttgcctttg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
32062673 |
aacataaaaaccttacctgtttctactggttttctaggttgactctcgcttgtttttgcctttg |
32062736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University