View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_20 (Length: 262)
Name: NF11661_low_20
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 38742592 - 38742842
Alignment:
| Q |
1 |
agaagcttgttcattcatttatatattatgattgtttacttttaatagcaannnnnnnnn-atgatgggaactttcattaacattatgcattccacacga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38742592 |
agaagcttgttcattcatttatatattatgattgtttacttttaatagcaattttttttttattatgg-aactttcattaacattatgcattccacacga |
38742690 |
T |
 |
| Q |
100 |
aatgatatgaagacccgtgacgtaagttattaaaaagaacatatggaaaagatatactagtgctcaatattttcttcaaattaagatattgaacacgaca |
199 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38742691 |
aatgagatgaagaccgttgacgtaagttattaaaaagaacatatggaaaagatatactagtgctcaatattttcttcaaattaagatattgaacacgaca |
38742790 |
T |
 |
| Q |
200 |
atttcaattgatactttggcagcaacatccaccagcttcttattgtcttcat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38742791 |
atttcaattgatactttggcagcaacatccaccagcttcttattgtcttcat |
38742842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 105
Target Start/End: Complemental strand, 38742910 - 38742873
Alignment:
| Q |
68 |
gaactttcattaacattatgcattccacacgaaatgat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38742910 |
gaactttcattaacattatgcattccacacgaaatgat |
38742873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 243
Target Start/End: Original strand, 38729590 - 38729621
Alignment:
| Q |
212 |
actttggcagcaacatccaccagcttcttatt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38729590 |
actttggcagcaacatccaccagcttcttatt |
38729621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 214
Target Start/End: Original strand, 1301168 - 1301201
Alignment:
| Q |
181 |
taagatattgaacacgacaatttcaattgatact |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1301168 |
taagatattgaacacgacaatttcaattgatact |
1301201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University