View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_26 (Length: 249)
Name: NF11661_low_26
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 92 - 218
Target Start/End: Complemental strand, 1355349 - 1355223
Alignment:
| Q |
92 |
cttatggacaaaactcttctcaatattagcaaatcttgttcaggattagaaatcattagtataaattggcattaattatatttttactcttgcaggttac |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
1355349 |
cttatggacaaaactcttctcaatattagcaaatcttgttcaggattagaaatcattagtataagttgacatttattatatttttactcttgcaggttac |
1355250 |
T |
|
| Q |
192 |
aacataataattagaattctgatatga |
218 |
Q |
| |
|
| |||||||||||||| |||||||||| |
|
|
| T |
1355249 |
agcataataattagaaatctgatatga |
1355223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 92 - 145
Target Start/End: Original strand, 1344238 - 1344291
Alignment:
| Q |
92 |
cttatggacaaaactcttctcaatattagcaaatcttgttcaggattagaaatc |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1344238 |
cttatggacaaaactcttcttaatattagcaaatcttgttcaggattagaaatc |
1344291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 128
Target Start/End: Original strand, 1361280 - 1361329
Alignment:
| Q |
83 |
atgagtaaccttatggacaaaactcttctcaa----tattagcaaatctt |
128 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
1361280 |
atgagtaaccttatggataaaactcttctcaacaattattagcaaatctt |
1361329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 47
Target Start/End: Original strand, 24618549 - 24618577
Alignment:
| Q |
19 |
ctggcaatcacaaggaaattattgcatag |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24618549 |
ctggcaatcacaaggaaattattgcatag |
24618577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University