View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_27 (Length: 244)
Name: NF11661_low_27
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 16695469 - 16695237
Alignment:
| Q |
1 |
caataatgtggttagtgcctcaatttataactcttggattcaatcaagcattttctattgttggacatactgagtttttcaacaaggaatctcctgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16695469 |
caataatgtggttagtgcctcaatttataactcttggattcaatcaagcattttctattgttggacatactgagtttttcaacaaggaatctcctgataa |
16695370 |
T |
|
| Q |
101 |
aatgagaagtattggtaattctttgctttcacttcaaacagcagttgcaagtaatttaagcactttcattgtgaacattattcatagttttagtggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16695369 |
aatgagaagtattggtaattctttgctttcacttcaaacagcagttgcaagtaatttaagcactttcattgtgaacattattcatagttttagtggaaaa |
16695270 |
T |
|
| Q |
201 |
caaggtcaacctgattggttggatagtgatgtc |
233 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
16695269 |
caaggtgaacctgattggttggatagtgatgtc |
16695237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 127
Target Start/End: Original strand, 25260517 - 25260584
Alignment:
| Q |
60 |
gttggacatactgagtttttcaacaaggaatctcctgataaaatgagaagtattggtaattctttgct |
127 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| ||||| | ||||||||||| | ||||||||||| |
|
|
| T |
25260517 |
gttggacacactgagtttttcaacaaagaatcacctgaaagcatgagaagtataagcaattctttgct |
25260584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University