View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_30 (Length: 241)
Name: NF11661_low_30
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_30 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 35357465 - 35357687
Alignment:
| Q |
19 |
tatggggcaggctttgtagggtgaagacaaaaattccattagtttataatgcattagatatatatctgtcacatgacaatcactcggtgagtttagaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35357465 |
tatggggcaggctttgtagggtgaagacaaaaattccattagtttataatgcattagatatatatctgtcacatgacaatcactcggtgagtttagaaac |
35357564 |
T |
|
| Q |
119 |
atctctctcatgcactgtgtgaaccaataatttgagtatgacaaaaagaatatcattattattatctgtgaatgctatgaatcatcatgtattgttttta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35357565 |
atctctctcatgcactgtgtgaaccaataatttgagtatggcaaaaagaatatcattactattatttgtgaatgctatgaatcatcatgtattgttttta |
35357664 |
T |
|
| Q |
219 |
aagaagaaagaactcatatattt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35357665 |
aagaagaaagaactcatatattt |
35357687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University