View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11661_low_31 (Length: 240)
Name: NF11661_low_31
Description: NF11661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11661_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 16695474 - 16695696
Alignment:
| Q |
1 |
ttgtgtaatttcatatgattctcctaatgaagtcgacgaaacccttcttcgttgttcgactaaccctgcaattaccattgttaaaattgcgaaaaaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16695474 |
ttgtgtaatttcatatgattctcctaatgaagtcgacgaaacccttcttcgttgttcgactaaccctgcaattaccattgttaaaattgcgaaaaaatgt |
16695573 |
T |
 |
| Q |
101 |
cctagtccgatcctttgaagggttgttaaccctccttcttggttggttaatttggtgagtatcggagaaatgactttatcatagaatggaatgactatag |
200 |
Q |
| |
|
|| ||||| |||||||||||| ||||||||||||| ||||||||||| | |||||| ||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16695574 |
ccaagtccaatcctttgaaggtttgttaaccctccgtcttggttggtcattttggtaagtgttggagaaatgactttatcatagaatggaatgactatag |
16695673 |
T |
 |
| Q |
201 |
ctattgttagcattgttactata |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16695674 |
ctattgttagcattgttactata |
16695696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University