View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11665_high_12 (Length: 245)
Name: NF11665_high_12
Description: NF11665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11665_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 18642516 - 18642285
Alignment:
| Q |
1 |
ttatattacatatttataactaaattgaannnnnnn-agactctttttaaaattaaattttgaggcttgagtatgaaccttcggttgaccggcctatagt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
18642516 |
ttatattacatatttataactaaattgaattttttttagactctttttaacatgaaattttgaggctagagtctgaaccttgggttgaccggcctatagt |
18642417 |
T |
 |
| Q |
100 |
taatggaaagaatatgttctctaatggataaggaataatatggctacattttccgcgactcgtagagcagagacttaatagtataaaattaataagagga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
18642416 |
taatggaaagaatatgttctctaatggataaggaataatatggctacattctccgcgactcgtagaggagagacttaatagtataaaattaataagggga |
18642317 |
T |
 |
| Q |
200 |
taatagagggagaaactcgagagatatgatgt |
231 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |
|
|
| T |
18642316 |
taatagagggagaaacgtgagagatatgatgt |
18642285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University