View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11665_low_11 (Length: 247)
Name: NF11665_low_11
Description: NF11665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11665_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 5925436 - 5925207
Alignment:
| Q |
1 |
gacaactcgaaaaagagttatgcattatcaacttttggaacaaaaataataaaagtgttgttgattacattcaccaatctcccattagcatggacttcgg |
100 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5925436 |
gacaactcggaaaagggttatgcattatcaacttttggaacaaaaataataaaagtgtcgttgactacattcaccaatctcctattagcatggacttcgg |
5925337 |
T |
|
| Q |
101 |
tcaagaatctcatagaatttcccttaaacttaaaattcagttaagaaatcgaaattgacatcatatgaacatgaacttttgcaggtatcacattcccaca |
200 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5925336 |
tcaagaatctcataaaattccccttaaacttaaaattctgttaagaaatcgaaattgacatcatatgaacctgaacttttgcaggtatcacattcccaca |
5925237 |
T |
|
| Q |
201 |
gcacatgtttatcttcctcttcactaaaag |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5925236 |
gcacatgtttatcttcctcttcactaaaag |
5925207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University