View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11665_low_14 (Length: 240)
Name: NF11665_low_14
Description: NF11665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11665_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 21612467 - 21612244
Alignment:
| Q |
1 |
tagatttataaatataatagctaatcaacaacttagccagtccgtnnnnnnnnn-catatgatcaacatatcatagtagcatgttgtgttggtcgaagga |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21612467 |
tagatttataaatataatagctaatcaacaacttagccggtccgtaaaaaaaaaacatatgatcaacatatcatagtagcatgttgtgttggtcgaagga |
21612368 |
T |
 |
| Q |
100 |
tttcaattagactcaaccgaaattcatatagaaatctttattattgaattataagtttattttattttacacaaattataagtttataatgaggtacatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
21612367 |
tttcaattagactcaaccgaaattcatatacaaatatttattattgaattataagtttattttattgtacacaaattataagtttacaatgaggtacatt |
21612268 |
T |
 |
| Q |
200 |
tatttaatgaaaatgggtatatta |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
21612267 |
tatttaatgaaaatgggtatatta |
21612244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University