View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11665_low_16 (Length: 225)
Name: NF11665_low_16
Description: NF11665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11665_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 32235732 - 32235511
Alignment:
| Q |
4 |
ttctgagtcatggttcaattggtctaactaaccaattgtggttcaacctagtttgatctggctctaccgaactatggttgaaccaaccaaaagactagct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32235732 |
ttctgagtcatggttcaattggtctaactaaccaattgtggttcaacctagtttgatctggctctaccaaactatggttgaaccaaccaaaagactagct |
32235633 |
T |
 |
| Q |
104 |
gattctcaattcaaccagttgaaccggccggtttggtccagttttgacaacattgcttaaacatttactatgtgataagatagtaaaatatgattggaag |
203 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32235632 |
gattctctaatcaaccagttgaaccggccggtttggtccagttttgacaacattgcttaaacatttactatgtgataagatagtaaaatatgattggaag |
32235533 |
T |
 |
| Q |
204 |
tctcttgtaaacttgttaacat |
225 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
32235532 |
tctcttttaaacttgttaacat |
32235511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University