View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11665_low_7 (Length: 299)
Name: NF11665_low_7
Description: NF11665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11665_low_7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 9241831 - 9242126
Alignment:
| Q |
1 |
aaaaatcactacagaacatattaaaaaactgactatccaatttatttcatagtggttcgcatcgggccacatatttaatctagttagactaaattaaatt |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9241831 |
aaaaatcactacagtacatattaaaaaaccgactatccaaattgtttcatagtggttcacatcgggccacatatttaatctagttagactaaattaaatt |
9241930 |
T |
|
| Q |
101 |
acgcaaaacacttgatttgtcaggattatgcaatccaaacatgtgcaaatttatgcacgtttttaaatcagccaaacatatgttgattttgtaattattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9241931 |
acgcaaaacacttgatttgtcaggattatgcaatccaaacatgtgcaaatttacccatgtttttaaatcagccaaacatatgttgattttgtaattattt |
9242030 |
T |
|
| Q |
201 |
taaattaatatttacattattgtttacaaattgtcctaacaatcatttaataccactcattactcttattgtttgcacaagcaactcaatttttgatga |
299 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9242031 |
taaattaa---ttacattattgtttacaaattgtcctaacaatcatttaataccactcgttactcttattgtttgcacaagcaactcaatttttgatga |
9242126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University