View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11666_high_14 (Length: 259)
Name: NF11666_high_14
Description: NF11666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11666_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 252
Target Start/End: Original strand, 39345551 - 39345785
Alignment:
| Q |
18 |
atttggaaccttcttcatcctttgccaaaccaatatcattaacccctcaaattcaaatatacctttaaaatggatgatgataaagacaaattaatcttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39345551 |
atttggaaccttcttcatcctttgccaaaccaatatcattaacccctcaaattcaaatatacctttaaaatggatgatgataaagacaaattaatcttga |
39345650 |
T |
 |
| Q |
118 |
ttcaagcttcatttatttaatctctattattcaaaattcctacaccttatgttttgatacaaacaaatgcctgtgtcggatcctagttctggccgcgcgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39345651 |
ttcaagcttcatttatttaatctctattattcaaaattcctacaccttatgttttgatacaaacaaatgcctgtgtcggatcctagttctggccgcgcgt |
39345750 |
T |
 |
| Q |
218 |
tcatatggcttgtaacatgtcttttattcatctct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39345751 |
tcatatggcttgtaacatgtcttttattcatctct |
39345785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University