View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11666_high_17 (Length: 213)
Name: NF11666_high_17
Description: NF11666
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11666_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 43349943 - 43349765
Alignment:
| Q |
12 |
gcagagagaaatgaaaacgttaaaggagtgataagaagaaagaatcgttgtgaatgaaaagaagaacggaatagagaggatagtcaccgaggtaaatttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43349943 |
gcagagagaaatgaaaacgttaaaggagtgataagaagaaagaatcgttgtgaatgaaaagaagaacggaatagagaggatagtcaccgaggtaaatttc |
43349844 |
T |
|
| Q |
112 |
accgaaggatccacttccgatcttgcggccgagcttgtagctgccgccaacgatgcgctccatgtttagaagaaggttc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43349843 |
accgaaggatccacttccgatcttgcggccgagcttgtagctgccgccaacgatgcgctccatgtttagaagaaggttc |
43349765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 33473090 - 33473049
Alignment:
| Q |
97 |
accgaggtaaatttcaccgaaggatccacttccgatcttgcg |
138 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
33473090 |
accgagatagatttcaccgaaggatccacttccgatcttgcg |
33473049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University