View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_high_36 (Length: 348)
Name: NF11668_high_36
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 19 - 343
Target Start/End: Complemental strand, 28581528 - 28581204
Alignment:
| Q |
19 |
atgactacttcaagaactgcctacaaaattgatgaacaacaccctggctctgatcttgcaggtgaaactgcagctgcattggcttctgcagccatagctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581528 |
atgactacttcaagaactgcctacaaaattgatgaacaacaccctggctctgatcttgcaggtgaaactgcagctgcattggcttctgcagccatagctt |
28581429 |
T |
 |
| Q |
119 |
tcaggccatacaactcttcttactctaatcttctgctagtacacgcaaaacaggtcagaggagtactaataatgcactctatttcccgcatatatctaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581428 |
tcaggccatacaactcttcttactctaatcttctgctagtacacgcaaaacaggtcagaggagtactaataatgcactctatttcccgcatatatctaat |
28581329 |
T |
 |
| Q |
219 |
caaagtttacactcaatattgagttattgatattcttctatctgttgcagctcttcacattcgcagataggtaccgaggtctatatgacgaatccatatc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581328 |
caaagtttacactcaatattgagttattgatattcttctatctgttgcagctcttcacattcgcagataggtaccgaggtctatatgacgaatccatatc |
28581229 |
T |
 |
| Q |
319 |
ttctgctaagcaattctatgcttct |
343 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
28581228 |
ttctgctaagcaattctatgattct |
28581204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 107
Target Start/End: Complemental strand, 13775839 - 13775778
Alignment:
| Q |
46 |
attgatgaacaacaccctggctctgatcttgcaggtgaaactgcagctgcattggcttctgc |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | ||||||||| ||||| |||||| |||| |
|
|
| T |
13775839 |
attgatgaacaacatcctggctctgatcttgctgctgaaactgctgctgctttggctgctgc |
13775778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University