View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_high_54 (Length: 246)
Name: NF11668_high_54
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_high_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 39032701 - 39032912
Alignment:
| Q |
18 |
aaaactgttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctctcgacatattttctag |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
39032701 |
aaaagtgttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctcgcgacata-tttctag |
39032799 |
T |
|
| Q |
118 |
caaaaagatgacgaccttgttgctagnnnnnnnnattgcaactacaattaatcaactctttcttttttatccaaccacccatgatgtccaccaatttaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032800 |
caaaaagatgacgaccttgttgctag-tttttttattgcaactac----aatcgactctttcttttttatccaaccacccatgatgtccaccaatttaga |
39032894 |
T |
|
| Q |
218 |
tctaacggtgacattctt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39032895 |
tctaacggtgacattctt |
39032912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University