View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_high_61 (Length: 238)
Name: NF11668_high_61
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_high_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 28581198 - 28580968
Alignment:
| Q |
1 |
ttattcagtgagtaaacatttctctattacttctttactcctattagcatccgatccatctaaattgacttctttggtaaaggatgaattgttatgggct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581198 |
ttattcagtgagtaaacatttctctattatttctttactcctattagcatccgatccatctaaattgacttctttggtaaaggatgaattgttatgggct |
28581099 |
T |
|
| Q |
101 |
gctgcctggctgcaccgagcaactggcgatgaatactacctaaagtacgtcgtggacaatgcggtgtatatgggtggaaccggatgggcggtgaaagagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28581098 |
gctgcctggctgcaccgagcaactggtgatgaatactacctaaagtacgtcgtggacaatgcggtgtatatgggtggaaccggatgggcggtgaaagagt |
28580999 |
T |
|
| Q |
201 |
tctcttgggacaacaaatatgctgatgtcca |
231 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
28580998 |
tctcttgggacaacaaatatgctggtgtcca |
28580968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University