View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_high_65 (Length: 236)
Name: NF11668_high_65
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_high_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 27 - 217
Target Start/End: Complemental strand, 8798352 - 8798162
Alignment:
| Q |
27 |
ttaatatttcgcttgtgattataaaagattaaattgtacttgtatagtaaatactaataaaataagaattgatccaagaaaaaagaatagagtgagtgag |
126 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8798352 |
ttaatattttgcttgtgattataaaagattaaattgtacttgtataataaatactaataaaataagaattgatctaagaaaaaagaatagagtgagtgag |
8798253 |
T |
|
| Q |
127 |
gtgagggagatagagagaaggattgattccgtgccctgtgaaatgaacctatcttccccaatatattcatcatcatcagcatagtagtagt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8798252 |
gtgagggagatagagagaaggattgattccgtgccctatgaaatgaacctatcttccccaatatattcatcatcatcagcatagtagtagt |
8798162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University