View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_28 (Length: 395)
Name: NF11668_low_28
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 19 - 361
Target Start/End: Complemental strand, 47441206 - 47440864
Alignment:
| Q |
19 |
agtctttgaaagatattgtgatgattttctcgtttgttcatagatactccgagtagggtaagatcaagtcctcacagtcacataatctgctcttattgtg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441206 |
agtctttgaaagatattgtgatgattttctcgtttgttcatagatactccgagtagggtaagatcaagtcctcacagtcacataatctgctcttattgtg |
47441107 |
T |
 |
| Q |
119 |
gaaaatttatgggcaattctaatttgcatgtcattattttgttaccaatataagtaaaatattgtattgttatacgagtgattaaagttgaatcatacta |
218 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441106 |
gcaaatttatgggcaattctaatttgcttgtcattattttgttaccaatataagtaaaatattgtattgttatacgagtgattaaagttgaatcatacta |
47441007 |
T |
 |
| Q |
219 |
cacatttatttttattgcaagtgtattttgaacatcttaaaaacggaagtgcctctagcattcatatgcgcccattgtcaacataattcttgagaaaggg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47441006 |
cacatttatttttattgcaagtgtattttgaacatcttaaaaacggaagtgcctctagcattcatatgcgcccattgtcaacataattcttgagaaaggg |
47440907 |
T |
 |
| Q |
319 |
aagaattggaaatgataatatagattcaatattatttttagca |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47440906 |
aagaattggaaatgataatatagattcaatattatttttagca |
47440864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University