View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_29 (Length: 393)
Name: NF11668_low_29
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_29 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 393
Target Start/End: Complemental strand, 31201542 - 31201169
Alignment:
| Q |
17 |
aaatagagaggactattagaaaattgatggaagatgatattgaagggaataagattagagatagagctttgaaattgaaggaagaggctaaggtttgttt |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31201542 |
aaatagagaggactattagaaaaatgatggaagatgatattgaagggaatgagattagagatagagctttgaaattgaaggaagaggctagggtttgttt |
31201443 |
T |
 |
| Q |
117 |
ggaaaaaggtggttcttcttgctctgctctggaaaggttggttgatcatattttgtcattggtgtcatttacttttgaagcttcatagcttaggtcgttt |
216 |
Q |
| |
|
| |||||||||||| |||||||||| | ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || | |||||| |
|
|
| T |
31201442 |
gaaaaaaggtggtttttcttgctcttccttgggaaggttggttgttcatattttgtcattggtgtcatttacttttgaagcttcatagtttggatcgttt |
31201343 |
T |
 |
| Q |
217 |
atgaaaaggatt---atttcttgaagagcaagaaatggttatgttgttg-ttgnnnnnnnagggaatgggtgttgtttaatttatctctctatagtcacg |
312 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||| || || || ||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
31201342 |
ccgaaaaggtttgtcatttcttgaagagcaagaaatggttatggtggtgtttttttttttagggaat-ggtgttgttt-ttttatctctctttagtcaca |
31201245 |
T |
 |
| Q |
313 |
ttaattaatatatgtggcatattttctttttgaggggtaagtgatgtattttatttggtgttacaatatgaagttaaattt |
393 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
31201244 |
ttaattaatataagtggcatattttct-----agggttaagtgatgtatttcatttggtgttagaatatgaagttaaattt |
31201169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 313 - 349
Target Start/End: Complemental strand, 31199245 - 31199209
Alignment:
| Q |
313 |
ttaattaatatatgtggcatattttctttttgagggg |
349 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31199245 |
ttaattaatataagtggcatattttctttttgagggg |
31199209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University