View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_35 (Length: 367)
Name: NF11668_low_35
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 12 - 256
Target Start/End: Original strand, 35609350 - 35609594
Alignment:
| Q |
12 |
agagacgttccatggtggtgaagattattgttgagatgggtttggagttaataatttgcagtactttatgagttaaggtaaagtagatcgatggtggaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609350 |
agagacgttccatggtggtgaagattattgttgagatgggtttggagttaataatttgcagtactttatgagttaaggtaaagtagatcgatggtggaaa |
35609449 |
T |
|
| Q |
112 |
tttgaagtactgatttaggtctctctagctagctgcaccgacatgtgtatgttctgatcataagattcattcataatcataactacaactagtagtagaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609450 |
tttgaagtactgatttaggtctctctagctagctgcaccgacatgtgtatgttctgatcataagattcattcataatcataactacaactagtagtagaa |
35609549 |
T |
|
| Q |
212 |
gaagaagaaaatggttatgatttaattcttgtactgaatcttgta |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609550 |
gaagaagaaaatggttatgatttaattcttgtactgaatcttgta |
35609594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 213 - 354
Target Start/End: Original strand, 35609594 - 35609733
Alignment:
| Q |
213 |
aagaagaaaatggttatgatttaattcttgtactgaatcttgtacgaaacattagtgtatttgtgaagcatgcgctttattatatagtctatattatttc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
35609594 |
aagaagaaaatggttatgatttaattcttgtactgaatcttgtacgaaacattagtgtatttgtgaagcatacgctttat--tatagtctatattatttc |
35609691 |
T |
|
| Q |
313 |
aattttcgtcggattactgttaatataattggtggatattga |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35609692 |
aattttcgtcggattactgttaatataattggtggatattga |
35609733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University