View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_36 (Length: 366)
Name: NF11668_low_36
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 235 - 353
Target Start/End: Original strand, 16984652 - 16984767
Alignment:
| Q |
235 |
ctaaaccatgaatgaacaagtataaagtaaacaattcttaccgatacagcttaagcaatatttgttttagagcaggagatgatctctcaatgcatgccat |
334 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16984652 |
ctaaaccatgaatgaacaagtataatgtaaaca---cttaccgataaagcttgagcaatatttgttttagagcaggagatgatctctcaatgcatgccat |
16984748 |
T |
|
| Q |
335 |
tctgataaaactgtcttct |
353 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
16984749 |
tctgataaaactgtcttct |
16984767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University