View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_39 (Length: 357)
Name: NF11668_low_39
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 23 - 350
Target Start/End: Complemental strand, 8889311 - 8888984
Alignment:
| Q |
23 |
gcggcggcggcggaagagctgatgaatgtgaaccagtcccagaagtccaagtataagaactcaaactaggactcatcggaggtggtggtggcggcattgg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8889311 |
gcggcggcggcggaagagctgatgaatgtgaaccagtcccagaagtccaagtataagaactcaaactaggactcatcggaggtggtggtggtggcattgg |
8889212 |
T |
 |
| Q |
123 |
cgacggagcacgcggcggcggtggtggaagaatgggttgtggctctggcggaagatggtggttaagatgagtggttttttcagcgttagcaaagtgaaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8889211 |
cgacggagcacgcggcggcggtggtggaagaatgggttgtggctctggcggaagatggtggttaagatgagtggttttttcagcgttagcaaagtgaaac |
8889112 |
T |
 |
| Q |
223 |
aaagctgaaccagttgaacgaagagaacggatgtacataacatgtgaagctgaaaaagcatgtcttgcttcaaccaactgtttcatgtaacgttttcttg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8889111 |
aaagctgaaccagttgaacgaagagaacggatgtacataacatgtgaagctgaaaaagcatgtcttgcttcaaccaactgtttcatgtaacgttttcttg |
8889012 |
T |
 |
| Q |
323 |
atttgcaatgtgacactgtttcttctct |
350 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8889011 |
atttgcaatgtgacactgtttcttctct |
8888984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University