View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_50 (Length: 278)
Name: NF11668_low_50
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 3 - 257
Target Start/End: Original strand, 46287503 - 46287760
Alignment:
| Q |
3 |
ctatttgctccatatttaaccatccatagttaaagatggctatt---attataaatcaaattaccaatttaatatagctggctggaatgtgcaaattacc |
99 |
Q |
| |
|
||||||| || ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46287503 |
ctatttgttcaatatttaaccatccaacgttaaagatggctattattattataaatcaaattaccaatttaatatagttggctggaatgtgcaaattacc |
46287602 |
T |
 |
| Q |
100 |
ctggctacttgccaacatagatgtcatgtcatgactacatataaagataataaaaattcaaccccaaatttaatagttccagttttggaaaacccacagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
46287603 |
ctggctacttgccaacatagatgtcatgtcatgactacatataaagataataaaaattcaaccccaaatttaatagttccagttttggaaaacccacaac |
46287702 |
T |
 |
| Q |
200 |
ctctcaaatagttttcttctccctaatttttcttccaccgatgttaccctaagacata |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46287703 |
ctctcaaatagttttcttctccctaatttttctttcaccgatgttaccctaagacata |
46287760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University