View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_55 (Length: 263)
Name: NF11668_low_55
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 252
Target Start/End: Original strand, 3845470 - 3845702
Alignment:
| Q |
19 |
atgcagcacatgaacgaagtttatatttcaagtcataatcattgttgtttttgttctctcgtcaattttacattgaagcatcgtttctgatcaaggaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
3845470 |
atgcagcacatgaacgaagtttatatttcgagtcataatcattgttgtttttgttctctcgtcaattttacattgaagcatcgtt-ctaatcaaggaaaa |
3845568 |
T |
 |
| Q |
119 |
aagctaaaagaacatacagggaatccagtttgatcaccagttgcggaaacaaataatttatggtttgcatatatcaaattgatgttcacttgcaataaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845569 |
aagctaaaagaacatacagggaatccagtttgatcaccagttgcggaaacaaataatttatggtttgcatatatcaaattgatgttcacttgcaataaga |
3845668 |
T |
 |
| Q |
219 |
cttctaaaattcccatacatacatttaacttcat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
3845669 |
cttctaaaattcccatacatacatttaacttcat |
3845702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University