View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_56 (Length: 258)
Name: NF11668_low_56
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 242
Target Start/End: Original strand, 33523330 - 33523565
Alignment:
| Q |
10 |
agaagaaaagcaagccaagatttgaggtattcataggagcaagagattcaaaaatcacaaaatcacatattttgggttgaaaaccatccatatttgtgtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523330 |
agaagaaaagcaagccaagatttgaggtattcataggagcaagagattcaaaaatcacaaaatcacatattttgggttgaaaaccatccatatttgtgtt |
33523429 |
T |
|
| Q |
110 |
tttcattactcaac---atgcaagcatccatcccttctctttcttcttccttgtggaatttgaaattccacaacgatggcaacattaattccatcctctt |
206 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523430 |
tttcattactcaacaacatgcaagcatccatcccttctctttcttcttccttgtggaatttgaaattccacaacgatggcaacattaattccatcctctt |
33523529 |
T |
|
| Q |
207 |
tccgagatgatcgtttcctaaattttgagcctttta |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523530 |
tccgagatgatcgtttcctaaattttgagcctttta |
33523565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University