View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_59 (Length: 251)
Name: NF11668_low_59
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 205
Target Start/End: Original strand, 39454258 - 39454454
Alignment:
| Q |
9 |
atgagatgaattatcataaaaatttgatttgttagattaaaaaatagtgcagtatgtatgaaatatgctgtgcatcaataaacgaacaaaacaattgatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39454258 |
atgagatgaattatcataaaaatttgatttgttagattaaaaaatagtgcagtatgtatgaaatatgctgtgcatcaataaacgaacaaaacaattgatc |
39454357 |
T |
|
| Q |
109 |
gagttaattggcctagtaattgtttttggtttgcatatttgaacaggtcagtatgatcattaatgaaacacttcggctctatcctccaactgcaagt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39454358 |
gagttaattggcctagtaattgtttttggtttgcatatttgaacaggtcagtatgatcattaatgaaacacttcggctctatcctccaactgcaagt |
39454454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 195
Target Start/End: Complemental strand, 39449153 - 39449095
Alignment:
| Q |
137 |
gtttgcatatttgaacaggtcagtatgatcattaatgaaacacttcggctctatcctcc |
195 |
Q |
| |
|
|||| |||||| |||||||||| ||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
39449153 |
gtttacatattccaacaggtcagcatgataattaatgaaacccttcgactctatcctcc |
39449095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University