View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_60 (Length: 250)
Name: NF11668_low_60
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 1613318 - 1613456
Alignment:
| Q |
1 |
attatagaaaattagagtttgctcccttgaatgatgattgaaacatatttcactccctcttgttaaaatatttttagaagggatttatactaatatctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
1613318 |
attatagaaaattagagtttgctcccttgaatgatgattgaaatatatttcactccctcttgttaaaatatttttagaagggatttatactaacatatgc |
1613417 |
T |
 |
| Q |
101 |
accacaagtagatatagaatgaaggtcaatcaaacggtc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1613418 |
accacaagtagatatagaatgaaggtcaatcaaacggtc |
1613456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 1613508 - 1613557
Alignment:
| Q |
191 |
tcatacaaatgacagtttttgtgttgattttaatctcgcggcgtcctttg |
240 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
1613508 |
tcatacaaatgacagttttcgtgttgattttaatctcgtggcgtcctttg |
1613557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University