View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_64 (Length: 245)
Name: NF11668_low_64
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 32076487 - 32076260
Alignment:
| Q |
1 |
ttttttcttccaaaactatataacaaagtctgaaaaataaagaaaaatctcattcgtcggtatttgttgtttctcacaactatagtgttgttatatagca |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32076487 |
tttttttttccaaaactatataacaaagtctgaaaa-taaagaaaaatctcattcgtcggtatttgttgtttctcacaactatagtgttgttatatagca |
32076389 |
T |
|
| Q |
101 |
acatggagaaattatttagaaaaatgtcagcaaccaacatgttatatatgcttgcattgtgtttttatatgcaccaacaacaaaatgaacatattt-nnn |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32076388 |
acatggagaaattatttagaaaaatgtcagcaaccaacatgttatatatgcttggattgtgtttttatatgcaccaacaacaaaatgaacatatttaaaa |
32076289 |
T |
|
| Q |
200 |
nnnnntgattagatttcatatcaatgaag |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32076288 |
caaaatgattagatttcatatcaatgaag |
32076260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University