View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_66 (Length: 243)
Name: NF11668_low_66
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 4534708 - 4534919
Alignment:
| Q |
18 |
tgaacaatcattgtgacatacacacacgtttacattgcagagagattatgcatgcaatgtggaaacctcaaaagttcaagtacatatattttctggcaac |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4534708 |
tgaacaattattgtgacatacacacacgtttgcattgcagagagattatgcatgcaatgtggaaacctcaaaagttcaagtacatatattttctggcaac |
4534807 |
T |
|
| Q |
118 |
tttgtacgttttcacattaacgattccttcagctgttgccgtttactgggcttttggtgatgagttgttaaaccattccaatgctttctctcttcttccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4534808 |
tttgtacgttttcacattaacgattccttcagctgttgccgtttactgggcttttggtgatgaattgttaaaccattccaatgctttctctcttcttccc |
4534907 |
T |
|
| Q |
218 |
aaaaatggattc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4534908 |
aaaaatggattc |
4534919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 52 - 227
Target Start/End: Original strand, 24628700 - 24628875
Alignment:
| Q |
52 |
ttgcagagagattatgcatgcaatgtggaaacctcaaaagttcaagtacatatattttctggcaactttgtacgttttcacattaacgattccttcagct |
151 |
Q |
| |
|
|||||||||||||||||| || |||||||| || ||||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
24628700 |
ttgcagagagattatgcacgccatgtggaagccacaaaaattcaagtacatatatttgatggcaactttatacgttttcacattaacgattccttctgcc |
24628799 |
T |
|
| Q |
152 |
gttgccgtttactgggcttttggtgatgagttgttaaaccattccaatgctttctctcttcttcccaaaaatggat |
227 |
Q |
| |
|
||| ||||| ||||| ||||| ||||| | | ||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
24628800 |
actgctgtttattgggcctttggagatgaacttcttaaccattccaatgctttctctctcctacctaaaaatggat |
24628875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University