View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_68 (Length: 240)
Name: NF11668_low_68
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 52153360 - 52153136
Alignment:
| Q |
1 |
tgtatcttgcattgtgaggttgcttcaagagtttggttgtgttttgttggcctgggcttaatttattgactccaacaaatttgtaaatttatttggtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52153360 |
tgtatcttgcattgtgaggttgcttcaagagtttggttgtgtttcgttggcctgggcttaatttattgactccaccaaatttgtaaatttatttggtttg |
52153261 |
T |
 |
| Q |
101 |
gttgcatggggaaggtagaaataagaagctttgaagggnnnnnnnatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaaggaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52153260 |
gttgcatggggaaggtagaaataagaagctttgaaggg-ttttttatactaatttggcattcaactatttgggtcgcggtttttgagtgtttaagggagg |
52153162 |
T |
 |
| Q |
201 |
ctggtgttgggttggcaggttggtgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52153161 |
ctggtgttgggttggcaggttggtgt |
52153136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University