View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_69 (Length: 238)
Name: NF11668_low_69
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 1613279 - 1613048
Alignment:
| Q |
1 |
tgaagaggatatgtggttctggcaattcaattcagccaaacgttacgttatgtgtaatgcatatgattacttgactgtaatggattctaatgttattcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
1613279 |
tgaagaggatatgtggttctggcaattcaattcggccaaacgttacgttgtgtgtaatgcatatgattacttgactgtaatggattctaatgttgttact |
1613180 |
T |
 |
| Q |
101 |
gatgacaactacaata-----ttcaacgctgttcct-------tttctttgtttgtttggcgtttgctgtttaatcgtctctctacaaaggataaccttt |
188 |
Q |
| |
|
||||||||||| |||| ||||| | ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
1613179 |
gatgacaactataatatttggttcaaagttgttcctcttaaagtttctttgtttgtttggcgtttgctgtttaatagtctctctacaaaggagaaccttt |
1613080 |
T |
 |
| Q |
189 |
tgaaaaaagaaattatttctttgaacaattgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
1613079 |
tgaaaaaagaaattatttctttgaacgattgt |
1613048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University