View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11668_low_76 (Length: 234)
Name: NF11668_low_76
Description: NF11668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11668_low_76 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 43695571 - 43695338
Alignment:
| Q |
1 |
ctgctttaggaattaaaagctatgtggagaaagccgtagaagttgaaaagttgaaggacaatgtggctgcggtagagctggaatcggggaggctaaaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695571 |
ctgctttaggaattaaaagctatgtggagaaagccgtagaagttgaaaagttgaaggacaatgtggctgcggtagagctggaatcggggaggctaaaggc |
43695472 |
T |
 |
| Q |
101 |
aaagctgattgctgctagggcaaatcttgacatggaaagaaatttgttgaaaatgaaaggattcgaagaaagagatttggattctgaattgggatgtggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43695471 |
aaagctgattgctgctagggcaaatcttgacatggaaagaaatttgttgaaaacgaaaggattcgaagaaagagatttggattctgaattgggatgtggg |
43695372 |
T |
 |
| Q |
201 |
agttggagaccatagacttatagctatgtatgga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43695371 |
agttggagaccatagacttatagctatgtatgga |
43695338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 194
Target Start/End: Original strand, 15827459 - 15827530
Alignment:
| Q |
123 |
aatcttgacatggaaagaaatttgttgaaaatgaaaggattcgaagaaagagatttggattctgaattggga |
194 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||| ||| ||||| |||||| ||||||||||||||| |
|
|
| T |
15827459 |
aatcttgacatggaaagagacttgttgaaatccaaaggtttcaaagaattagatttagattctgaattggga |
15827530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University