View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_high_2 (Length: 505)
Name: NF11669_high_2
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 8e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 8e-50
Query Start/End: Original strand, 330 - 430
Target Start/End: Complemental strand, 32963790 - 32963690
Alignment:
| Q |
330 |
cgaaagataaggttccaatacctttcagtacattttaaaaaataaaggcaaaatgaaaatgtggatggttcaaaagatgcattacattttcttataccaa |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32963790 |
cgaaagataaggttccaatacctttcagtacattttaaaaaataaaggcaaaatgaaaatgtggatggttcaaaagatgcattacattttcttataccaa |
32963691 |
T |
|
| Q |
430 |
g |
430 |
Q |
| |
|
| |
|
|
| T |
32963690 |
g |
32963690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 32964749 - 32964621
Alignment:
| Q |
1 |
gtgaaaatcgaataaagatgaagaagaggttgagtaggagctnnnnnnnnnnnnnnnnncatgtggtgtatcaaattaattttccagaaaacctctttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
32964749 |
gtgaaaatcgaataaagatgaagaagaggttgagtaggagctaaaagaaaaaagaaaaacatgtggtgtatcaaataaattttctagaaaacctctttga |
32964650 |
T |
|
| Q |
101 |
aacttgagaacgagaacgtctttcgcaaa |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
32964649 |
aacttgagaaagagaacgtctttcgcaaa |
32964621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 431 - 489
Target Start/End: Complemental strand, 32963418 - 32963360
Alignment:
| Q |
431 |
atgggggcctaaacaacaaatttcagacacaattagctgaatttggcccattcgtcatg |
489 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32963418 |
atgggggcctaaacaacaaatttcagacacaattagctgaatttggcccattcgtcatg |
32963360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University