View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_high_29 (Length: 238)
Name: NF11669_high_29
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_high_29 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 55336841 - 55337063
Alignment:
| Q |
16 |
gttccaattttgacgctgttcgcagatgtttttgtgcatttcaattctgtcagatacagaatctaagatagcatagagttgcacggtgttggagttattg |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55336841 |
gttccaattttgacgctgttcgccgatgtttttgtgcatttcaattctgtcagatacagaatctaagatagcatagagttgcacggtgttggagttattg |
55336940 |
T |
 |
| Q |
116 |
attgtagaattggataaatcatggtgtaaattatgtgtcctattgatgacannnnnnncaagcaataatgaaggaactgagtctttgaaggttaaccctt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55336941 |
attgaagaattggataaatcatggtgtaaattatgtgtcctattgatgacatttttttcaagcaataatgaaggaactgagtctttgaaggttaaccctt |
55337040 |
T |
 |
| Q |
216 |
caaccagctttgcagtgggtatc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
55337041 |
caaccagctttgcagtgggtatc |
55337063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 98
Target Start/End: Original strand, 55331403 - 55331485
Alignment:
| Q |
16 |
gttccaattttgacgctgttcgcagatgtttttgtgcatttcaattctgtcagatacagaatctaagatagcatagagttgca |
98 |
Q |
| |
|
||||||||| || ||||||| || || ||| ||||||||||| |||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
55331403 |
gttccaattctgtcgctgttggctgaggttgttgtgcatttcgattctgtcggatacagaatctaaaattgcatagagttgca |
55331485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University