View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_low_17 (Length: 267)
Name: NF11669_low_17
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 36442878 - 36442628
Alignment:
| Q |
11 |
caaaggacaatacatgaccttaaaaatatatattaattatgtctcagttgtnnnnnnnnnnnnnnnnn-tagaatattaacaaacttggagaaacgtcac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
36442878 |
caaaggacaatacatgaccttaaaaatatatattaattatgtctcagttgtaaaaaataaaaataaaaataaaatattaacaaacttggagaaacgtcac |
36442779 |
T |
|
| Q |
110 |
gggcttg----agttaataaactactcagagtaatccgtatattaatttaggccctttcattgtt---tgcctctcacgttgcattccaaaaagggatag |
202 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36442778 |
gggcttgcttgagttaataaactactcagagtaatccgtatattaatttaggccctttcattgttgcctgcctctcacgttgcattccaaaaagggatag |
36442679 |
T |
|
| Q |
203 |
ctttcttcacaatattattattagatcaattttctgtcactttttaatttt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36442678 |
ctttcttcacaatattattattagatcaattttctgtcactttttaatttt |
36442628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University