View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_low_20 (Length: 252)
Name: NF11669_low_20
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_low_20 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 2616141 - 2616376
Alignment:
| Q |
17 |
aggctaagtggtcacatccaatttatttaaagtgacttttcaagtagattgaggttgaattgctattttaaatttaacttcaagggctttataaatacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616141 |
aggctaagtggtcacatccaatttatttaaagtgacttttcaagtagattgaggttgaattgctattttaaatttaacttcaagggctttataaatacca |
2616240 |
T |
|
| Q |
117 |
acgcctatcaacattggaacatatcacatattctttggagacnnnnnnngatcaataataatggcgtggaaaacactttttgtattgtgtttcttcctca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2616241 |
acgcctatcaacattggaacatatcacatattctttggagacaaaaaaagatcaataataatggcgtggaaaacactttttgtattgtgtttcttcctca |
2616340 |
T |
|
| Q |
217 |
ttgttgccctatcttcccgtaagtccatattaaata |
252 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2616341 |
ttgctgccctatcttcccgtaagtccatattaaata |
2616376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University