View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_low_22 (Length: 249)
Name: NF11669_low_22
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 11 - 231
Target Start/End: Complemental strand, 13971626 - 13971406
Alignment:
| Q |
11 |
cagagattggtattatcaaaatagcggaacaaggattccaggacacgtcttacagttgtaccttccttggctaacttcgccatatttagtatgcaaactc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13971626 |
cagagattggtattatcaaaatagcggaacaaggattccaggacacgtcgtacagttgtaccttccttggctaacttagccatatttagtatacaaactc |
13971527 |
T |
 |
| Q |
111 |
ttgaccaaaatccagggttcgtagcatcttccctatggaggagaaatgaagttaacatcaattataacatacgagtaactcaaaacaaaagctaatataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13971526 |
ttgaccaaaatccagggttcgtagcatcttccctatggaggagaaatgaagttaacatcaattataacatacgagtaactcaaaacgaaagctaatataa |
13971427 |
T |
 |
| Q |
211 |
caagaaggacagttacatagg |
231 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
13971426 |
caagaatgacagttacatagg |
13971406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University