View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11669_low_36 (Length: 214)
Name: NF11669_low_36
Description: NF11669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11669_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 45107783 - 45107961
Alignment:
| Q |
17 |
cagatagagaaacataaaccaatgagcataggggttactaaccccaaaagtgaaatcgtccatccttttcttcctgtccttctgatcatgttgaaatcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107783 |
cagatagagaaacataaaccaatgagcataggggttactaaccccaaaagcgaaatcgtccatccttttcttcctgtccttctgatcatgttgaaatcca |
45107882 |
T |
 |
| Q |
117 |
ttttcacgcctgtttcgaacagaaacaacacatagccaagtcctgcaatggttgcaagtgtgtcttgactcccataagg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107883 |
ttttcacgcctgtttcgaacagaaacaacacataaccaagtcctgcaatggttgcaagtgtgtcttgactcccataagg |
45107961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University