View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_43 (Length: 329)
Name: NF1166_high_43
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 34 - 315
Target Start/End: Complemental strand, 8016751 - 8016470
Alignment:
| Q |
34 |
agatacctcatttgctttgcaatgaaagcttctatcgtacgctgaaactcttcattactcagcttatcctccggatacaaaacttccctcaccttctcct |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016751 |
agatacctcatttgctttgcaatgaaagcttctatcgtacgctgaaactcttcattacttagcttatcctccggatacaaaacttccctcaccttctcct |
8016652 |
T |
 |
| Q |
134 |
tctccggcagagactgacttcgactataaacctttcttcccaagttaccagaacctgttgcatagcatgaatctatatcatccttagaactgtccttaat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016651 |
tctccggcagagactgacttcgactataaacctttcttcccaagttaccagaacctgttgcatagcatgaatctatatcatccttagaactgtccttaat |
8016552 |
T |
 |
| Q |
234 |
ctgttcatccactggagctgcagaattggcggataaagaggaggagaggaggtcagactgaacgaggagggcggcgatgata |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016551 |
ctgttcatccactggagctgcagaattggcggatgaagaggaggagaggaggtcagactgaacgaggagggcggcgatgata |
8016470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University