View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_45 (Length: 321)
Name: NF1166_high_45
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_45 |
 |  |
|
| [»] scaffold0649 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0649 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 166 - 310
Target Start/End: Complemental strand, 6027 - 5883
Alignment:
| Q |
166 |
ataatgtacttttcatgcttcgannnnnnnaatacgtttgtagaccaacccggtaacgaatttccaaaagggagtgaataatgtaccttgaacaatttca |
265 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6027 |
ataatgtacttttcatgcttcggtttttttaatacgtttgtagaccaacccggtaacgaatttccaaaagggagggaataatgtaccttgaacaatttca |
5928 |
T |
 |
| Q |
266 |
tcttcatagttataataaatataagaaaaacaaaagtttattcat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5927 |
tcttcatagttataataaatataagaaaaacaaaagtttattcat |
5883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0649; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 41 - 167
Target Start/End: Complemental strand, 6199 - 6074
Alignment:
| Q |
41 |
aaatacagtcctatacatgtaccaagagttgtgtttacatagattctatgacaatatcagaagaacaacaatatccaagaattggtgtagaaataaagta |
140 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6199 |
aaatacagtc-tatacatgtaccaagagttgtgtttacatagattctatggcaatatcagaagaacaacaatatccaagaattggtgtagaaataaagta |
6101 |
T |
 |
| Q |
141 |
attctcacttcatgaatcattatggat |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6100 |
attctcacttcatgaatcattatggat |
6074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0649; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 6252 - 6219
Alignment:
| Q |
12 |
taaatgcataattcaatatcggaagaaagaaata |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6252 |
taaatgcataattcaatatcggaagaaagaaata |
6219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 113 - 167
Target Start/End: Complemental strand, 20968400 - 20968346
Alignment:
| Q |
113 |
atccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
167 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20968400 |
atccaagaactggtgtagaaataaagtaattctcacttcatgaatcatcatggat |
20968346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University