View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_60 (Length: 261)
Name: NF1166_high_60
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_60 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 261
Target Start/End: Original strand, 2654754 - 2654986
Alignment:
| Q |
29 |
atttggttattattatatcatgtcaataaagttgtgccttcttaattactcaaatgtctaaaaaatgggttccctcctgcccatgctctgggagagtttg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
2654754 |
atttggttattattatatcatgtcaataaagttgtgcctttttaattactcaaatgtctaaaaaatgggttccctcctccctatgctttgggagagtttg |
2654853 |
T |
 |
| Q |
129 |
taatattgcagatataattagcatcataacttgaataatattcacactgatccattcaatgagttgatataattttccaaacactttatgtaaaccatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654854 |
taatattgcagatataattagcatcataacttgaataatattcacactgatccattcaatgagttgatataattttccaaacactttatgtaaaccatat |
2654953 |
T |
 |
| Q |
229 |
ataatctagtgagacctgatggattaaaccata |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2654954 |
ataatctagtgagacctgatggattaaaccata |
2654986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University