View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_66 (Length: 252)
Name: NF1166_high_66
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 77 - 231
Target Start/End: Complemental strand, 1251620 - 1251475
Alignment:
| Q |
77 |
ataaagaggtaaagggtgtcttcatttcacaattcacatggatgagatggtaatttaaaattgaataggaaaacaaataaattaaatcaaacatagctat |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
1251620 |
ataaagaggtaaagggtgtcttcatttcacaattcacatggatgagatggtaatttaaaat-----aggaaaacaaataaa----atcaaacatagctaa |
1251530 |
T |
 |
| Q |
177 |
caaaatggcagggttaattttcatgtatgcaaaatcttgcttcttccaacattgt |
231 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251529 |
caaaatggcaggattaattttcatgtatgcaaaatcttgcttcttccaacattgt |
1251475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 1251712 - 1251647
Alignment:
| Q |
13 |
aatatgtcatcctccatacttaactacaactacatatcatgttacctttaagttttatgctcaaat |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1251712 |
aatatgtcatcctccatacttaactacaactacatatcatgttacctttaagttttatgctcaaat |
1251647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 244
Target Start/End: Complemental strand, 15029052 - 15029020
Alignment:
| Q |
212 |
cttgcttcttccaacattgtctaataatattag |
244 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
15029052 |
cttgcttcttcaaacattgtctaataatattag |
15029020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University