View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_71 (Length: 251)
Name: NF1166_high_71
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_71 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 37156980 - 37157222
Alignment:
| Q |
9 |
gaagaatatgatgtaatcgtcctaggcactggcctcaaggaatgcatccttagtggtcttctctctgttgatggcctcaaagtaattcattcattctctc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37156980 |
gaagaatatgatgtaatcgtcctaggcactggcctcaaggaatgcatccttagtggtcttctctctgttgatggcctcaaagtaattcattcattctctc |
37157079 |
T |
|
| Q |
109 |
actctttataatttatttgtttgtgtctttttcttttatacaattatgtactcaaatgtattatagattgtcatataagttgnnnnnnnctcttatacaa |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37157080 |
actctttataatttatttgattgtgtctttttcttttatacaattatgtactcaaatgtattatagattgtcatataagttgtttttttctcttatacaa |
37157179 |
T |
|
| Q |
209 |
ttatttgatagtgatcaaatgtaactacatgtcagcatcatat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37157180 |
ttatttgatagtgatcaaatgtaactacatgtcagcatcatat |
37157222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 9 - 93
Target Start/End: Complemental strand, 36795475 - 36795391
Alignment:
| Q |
9 |
gaagaatatgatgtaatcgtcctaggcactggcctcaaggaatgcatccttagtggtcttctctctgttgatggcctcaaagtaa |
93 |
Q |
| |
|
||||| || ||||||||||| || || ||||| |||||||||||| | || ||||||||||||||||| |||||||||||||||| |
|
|
| T |
36795475 |
gaagagtacgatgtaatcgttctgggaactggtctcaaggaatgcgttctcagtggtcttctctctgtcgatggcctcaaagtaa |
36795391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University