View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1166_high_73 (Length: 244)
Name: NF1166_high_73
Description: NF1166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1166_high_73 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 51 - 244
Target Start/End: Complemental strand, 48482787 - 48482594
Alignment:
| Q |
51 |
actttttcttctgaatttgctcnnnnnnnggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacat |
150 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482787 |
actttttcttctgaatttgctctttttttggagggcagcaaagtcatttatgtccataatcaatatatagatttttatggaagtaagcatttagttacat |
48482688 |
T |
 |
| Q |
151 |
ggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482687 |
ggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgttctacagtgaagaaggggactcaaataacacagacg |
48482594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University